Transcript Dmel\mir-79-RA

General Information
Symbol	Dmel\mir-79-RA	Species	D. melanogaster
Annotation Symbol	CR33570-RA	FlyBase ID	FBtr0091547
Feature type	miRNA	Associated gene	Dmel\mir-79
Created / Updated	2005-01-26/2005-01-26

Evidence Rank		Length (nt)	22
Evidence Score

Map ( GBrowse )
cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the annotated transcript, internally consistent
End(s) extend beyond the annotated transcript, internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the annotated transcript, internally consistent
End(s) extend beyond the annotated transcript, internally consistent
Sequence
	TAAAGCTAGATTACCAAAGCAT
Other Products of this Gene

External Crossreferences
	RefSeq - An integrated, non-redundant set of sequences • NR_002236
Synonyms
	mir-79-RA
References ( 1 )
Personal communication to FlyBase	FlyBase Curators et al., 2004-, Gene Ontology annotation in FlyBase through association of InterPro records with GO terms. Gene Ontology annotation in FlyBase through association of InterPro records with GO terms. [FBrf0174215]