A Database of Drosophila Genes & Genomes

 

Transcript Dmel\mir-6-1-RA

General Information
Symbol Dmel\mir-6-1-RA Species D. melanogaster
Annotation Symbol CR33004-RA FlyBase ID FBtr0086488
Feature type miRNA Associated gene Dmel\mir-6-1
Created / Updated 2002-08-20/2006-05-09
Evidence Rank Length (nt) 22
Evidence Score
Map ( GBrowse ) detailed view FBtr0086471 FBtr0086472
hide cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the
annotated transcript,
internally consistent
End(s) extend beyond
the annotated transcript,
internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the
annotated transcript,
internally consistent
End(s) extend beyond
the annotated transcript,
internally consistent
hide Sequence
TATCACAGTGGCTGTTCTTTTT
hide Other Products of this Gene
hide External Crossreferences
RefSeq - An integrated, non-redundant set of sequences
hide Synonyms
mir-6-1-RA
 
hide References ( 0 )
No references are recorded in FlyBase at present.