A Database of Drosophila Genes & Genomes

FB2008_07, released August 8, 2008
 

Transcript Dmel\mir-12-RA

General Information
Symbol Dmel\mir-12-RA Species D. melanogaster
Annotation Symbol CR33076-RA FlyBase ID FBtr0074044
Feature type miRNA Associated gene Dmel\mir-12
Created / Updated 2002-08-21/2006-05-09
Evidence Rank Weakly Supported Length (nt) 23
Evidence Score 0
Map ( GBrowse ) detailed view FBtr0074042 FBtr0074043 FBtr0100142 FBtr0074073
hide cDNA Clones Consistent with the Transcript ( 0 )
cDNA Clones, Fully Sequenced
Exact Match
Contained within the
annotated transcript,
internally consistent
End(s) extend beyond
the annotated transcript,
internally consistent
cDNA Clones, End Sequence Only (ESTs)
Contained within the
annotated transcript,
internally consistent
End(s) extend beyond
the annotated transcript,
internally consistent
hide Sequence
TGAGTATTACATCAGGTACTGGT
hide Other Products of this Gene
hide External Crossreferences
RefSeq - An integrated, non-redundant set of sequences
hide Synonyms
mir-12-RA
 
hide References ( 0 )
No references are recorded in FlyBase at present.