Clone Dmel\RH60039

General Information
Symbol	Dmel\RH60039	Species	D. melanogaster
Name	RH60039	FlyBase ID	FBcl0267272
Feature type	cDNA_clone	Created / Updated	2005-11-02/2006-08-19
Computed gene(s)	Dmel\Dcp1

Collection Status	BDGP
Known Problems	none
Library	RH
Strain	y; cn bw sp
Tissue Source	adult stage head
Vector	pFLC-I
Sequence Data of the Insert
5' Sequence
Total bases	526
GenBank	BI630748
5' sequence data	GAATTCGCAATAGCACAGCCAAAACTGAAGATTACATACAATTTACAATG GCCGACGAGAGCATCACGCGAATGAACCTGGCGGCCATCAGGAAGATCGA CCCGTACGCCAAGGAGATCGTGGATTCGTCCTCGCACGTCTGCCTTCTAC ACGTTCAACTCGTCGCAGAACGAGTGGGAAAAGACCGATGTGGAGGGAGC CTTCTTCATATACCACCGCAACGCGGAGCCCTTTCACAGCATCTTCATCA ACAACCGACTGAACACCACGTACTTCGTGGAGCCCATCACCGGCAGCCTG GAGCTGCAGTCGCAGCCGCCGTTCCTGCTCTACCGCAACGAGCGCTCGCG CATCCGCGGCTTCTGGTTCTACAACAGCGAGGAGTGCGACCGCATCAGCG GCTTGGTGAACGGGCTGCTCAAGTCCAAGGATCAGGGAACGAATGGCCAG GCCCAGCGTCACGTCTCCGCGCCCCAGCAGCCAAAGCAGGACAGCAGCCA GCCGGCCAGCATATTCAACATGCTGA
Library Information
Comments	The RH (Riken head) library was made from RNA extracted from Drosophila adult heads, from the isogenic y; cn bw sp strain, polyA+ selected once, RNA made by Ling Hong. cDNA was synthesized by priming with the oligo(dT) primed adapter (5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3'). The first strand was synthesized in presence of trehalose, which increases the full-length cDNA synthesis (Carninci, P. et. al., PNAS 95: 520-524; Carninci, P. et al., Methods Enzymol. 303: 19-44). Subsequently, full-length cDNA was selected with the biotinylated cap-trapper (Carninci, P. et al., Genomics 37: 327-336). A linker was then ligated to the single-strand cDNA following the published protocol (Shibata, Y., et al., Biotechniques, in press). Subsequently, the cDNA was normalized by using RoT=1.0 as published (Carninci, P., et al., Genome Res. 10: 1617-1630). Second strand cDNA was primed with the (5'-AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3') primer. After restriction digestion of the hemimethylated cDNA with BamHI and XhoI, thecDNA was cloned in the lambda FLC-I vector. Subsequently, the library was bulk-excised into pFLC-I plasmid as described (Carninci, P., et al., Genomics, 2001, 77:79-90). cDNAs were transformed into DH5-alpha TonA strain.
Library Synonyms
Reported As
Symbol Synonym
Library References
Research paper	Stapleton et al., 2002, Genome Res. 12(8): 1294--1300 The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs

References ( 0 )
Research paper	Stapleton et al., 2002, Genome Res. 12(8): 1294--1300 The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]