A Database of Drosophila Genes & Genomes

FB2008_07, released August 8, 2008
 

Clone Dmel\RE17792

General Information
Symbol Dmel\RE17792 Species D. melanogaster
Name RE17792 FlyBase ID FBcl0194697
Feature type cDNA_clone Created / Updated 2005-11-01/2006-08-19
Computed gene(s) Dmel\Fmr1
Collection Status BDGP
Known Problems none
Library RE
Strain y; cn bw sp
Tissue Source embryonic stage whole organism
Vector pFLC-I  
hide Sequence Data of the Insert
5' Sequence
Total bases 400
GenBank BI212667
5' sequence data GGGGAGTTGAAGGCTGGGCAGCATCAGCATCAGCAGCAGGAGGGACAGGG
ACGGACGGCGAAGAACCACCAGAACCAGAACCAAAACAAAGCGGATAAAC
CAGGAGGCACTACGTCTGGCGATATGGAAGATCTCCTCGTGGAAGTTCGG
CTCGACAATGGCGCCTACTACAAGGGCCAGGTGACAGCTGTCGCCGATGA
TGGCATCTTTGTGGATGTGGACGGCGTGCCCGAGAGTATGAAATATCCAT
TTGTGAACGTTCGCCTGCCGCCCGAGGAAACCGTTGAGGTGGCCGCACCG
ATCTTCGAGGAGGGCATGGAAGTGGAGGTGTTCACGCGCACGAACGATCG
GGAAACCTGCGGCTGGTGGGTGGGCATTATTAAAATGCGCAAAGCGGAAA
hide Library Information
Comments
  • The RE (Riken embryo) library was made from RNA extracted from Drosophila 0-22hr mixed stage isogenic y; cn bw sp strain embryos, polyA+ selected twice, RNA made by Ling Hong. cDNA was synthesized by priming with the oligo(dT) primed adapter (5'-GAGAGAGAGAGGATCCAATACTGGAGAGTTTTTTTTTTTTTTTTVN-3'). The first strand was synthesized in presence of trehalose, which increases the full-length cDNA synthesis (Carninci, P. et. al., PNAS 95: 520-524; Carninci, P. et al., Methods Enzymol. 303: 19-44). Subsequently, full-length cDNA was selected with the biotinylated cap-trapper (Carninci, P. et al., Genomics 37: 327-336). A linker was then ligated to the single-strand cDNA following the published protocol (Shibata, Y., et al., Biotechniques, in press). Subsequently, the cDNA was normalized by using RoT=1.0 as published (Carninci, P., et al., Genome Res. 10: 1617-1630). Second strand cDNA was primed with the (5'-AGAGAGAGAGCTCGAGCTCTAATAAGGTGACACTATAGAACCA-3') primer. After restriction digestion of the hemimethylated cDNA with BamHI and XhoI, the cDNA was cloned in the lambda FLC-I vector. Subsequently, the library was bulk-excised into pFLC-I plasmid as described (Carninci, P., et al., Genomics, 2001, 77:79-90). cDNAs were transformed into DH5-alpha TonA strain.
hide Library Synonyms
Reported As
Symbol Synonym
hide Library References
Research paper
Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
hide External Crossreferences & Linkouts
Linkouts
DGRC - Stock center for Drosophila cDNAs, vectors, and cell lines
hide Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs
hide References ( 1 )
Research paper
Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]