Clone Dmel\LD29795

General Information
Symbol	Dmel\LD29795	Species	D. melanogaster
Name	LD29795	FlyBase ID	FBcl0166954
Feature type	cDNA_clone	Created / Updated	2005-11-01/2006-08-19
Computed gene(s)	Dmel\pcm

Collection Status	BDGP
Known Problems	none
Library	LD_pOT2
Strain	y; cn bw sp
Tissue Source	embryonic stage whole organism
Vector	pOT2
Sequence Data of the Insert
5' Sequence
Total bases	263
GenBank	AA949784
5' sequence data	CAAAGCTTCTCCCTGTCGCCTACCACGACCTCATGCTGCTGCCGACCAGC CCGCTGGCCGAGTTCTATCCACTGGAGTTCGAGAGCGACCTCAATGGCAA GAAACACGATTGGGAGGCGGTTGTGCTGATACCCTTCATCGATGAGGGTC GGCTGCTGGCCGCTATGCTGCCATGCGAGGCTCAGCTGTCGCTGGAGGAG CGCGAACGCAACCGACACGGTCCCATGTATGTGTACAAATACAGTACGGT GGCGCAGGGTCCC
Library Information
Comments	mRNA source--0-22hr embryos, from an isogenic y; cn bw sp strain, polyA+ selected twice. cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; size fractionated on Sephacryl S-500--approximately 1-6kb. For clones LD01001-LD21096, cDNA directionally cloned into EcoRI/XhoI-digested Stratagene Uni-Zap XR vector, which allows in vivo excision and recircularization of pBluescript SK(+/-) plasmid. For clones LD21101 and higher, cDNA directionally cloned into EcoRI/XhoI-digested pOT2 plasmid.
Library Synonyms
Reported As
Symbol Synonym	LD (Rubin et al., 2000) LD_pOT2 (Rubin et al., 2000)
Library References
Review	Rubin et al., 2000, Science 287(5461): 2222--2224 A Drosophila complementary DNA resource. [FBrf0127297]
Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs

References ( 1 )
Review	Rubin et al., 2000, Science 287(5461): 2222--2224 A Drosophila complementary DNA resource. [FBrf0127297]