A Database of Drosophila Genes & Genomes

FB2008_06, released July 3, 2008
 

Clone Dmel\EK125801

General Information
Symbol Dmel\EK125801 Species D. melanogaster
Name EK125801 FlyBase ID FBcl0101304
Feature type cDNA_clone Created / Updated 2006-05-12/2006-08-19
Computed gene(s) Dmel\Dcp1
Collection Status N/A
Known Problems none
Library EK_EP
Strain
Tissue Source embryonic stage whole organism & larval stage imaginal disc & adult stage head
Vector pCDNA-SK+  
hide Sequence Data of the Insert
5' Sequence
Total bases 190
GenBank CO277681
5' sequence data TTTCACAGCATCTTCATCAACAACCGACTGAACACCACGTCCTTCGTGGA
GCCCATCACCGGCAGCCTGGAGCTGCAGTCGCAGCCGCCGTTCCTGCTCT
ACCGCAACGAGCGCTCGCGCATCCGCGGCTTCTGGTTCTACAACAGCGAG
GAGTGCGACCGCATCAGCGGCTTGGTGAACGGGCTGCTCA
hide Library Information
Comments
  • All clones are from a random primed, normalized library from mixed stage embryos, imaginal disks, and adult heads. Clones with EK designations were selected for initial sequencing. Those with EP designations are a subset of clones that were sequenced from the 3' end. These were clones that did not initially overlap other contigs and where the 5' end did not read into vector (i.e. inserts >~500bp). Vector: pCDNA-sk+ standard.
hide Library Synonyms
Reported As
Symbol Synonym
hide Library References
Personal communication to FlyBase
Carlson, 2005.9.12, FlyTag EST project.
FlyTag EST project. [FBrf0188689]
Unpublished
Platt et al., 2005, FlyTag CK02 EST Project.
FlyTag CK02 EST Project. [FBrf0186301]
Kopczynski et al., 2004, FlyTag CK01 EST Project.
FlyTag CK01 EST Project. [FBrf0185710]
hide Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs
hide References ( 0 )
Personal communication to FlyBase
Carlson, 2005.9.12, FlyTag EST project.
FlyTag EST project. [FBrf0188689]
Unpublished
Platt et al., 2005, FlyTag CK02 EST Project.
FlyTag CK02 EST Project. [FBrf0186301]
Kopczynski et al., 2004, FlyTag CK01 EST Project.
FlyTag CK01 EST Project. [FBrf0185710]