Clone Dmel\EK212764

General Information
Symbol	Dmel\EK212764	Species	D. melanogaster
Name	EK212764	FlyBase ID	FBcl0051400
Feature type	cDNA_clone	Created / Updated	2006-05-12/2006-08-19
Computed gene(s)	Dmel\Dcp2

Collection Status	N/A
Known Problems	none
Library	EK_EP
Strain
Tissue Source	embryonic stage whole organism & larval stage imaginal disc & adult stage head
Vector	pCDNA-SK+
Sequence Data of the Insert
5' Sequence
Total bases	287
GenBank	CO296129
5' sequence data	TCCTAGGCCTTGGAGACTATGTATATAAGTAAAGTTTCTCGATCTCTGTA CTGGAGATCAAGCTTTTCCAGACATATATATATATTCTACGTTAGGGAAC CACAAACACACCTTAACTCGAAAATTGAATGCGATCAATTGTATAGGACA TTTTTAATACGAGAAAGAACAAGATTTTCATACCAAAAAGAAAAAAAGAA AAGTAAAACATAAACGAGAGTCTTCCGCTCAGCACACGTAAAGTAATATT TTGTAATAACACTACAATCGCTGTTCGACTTTAAGAT
Library Information
Comments	All clones are from a random primed, normalized library from mixed stage embryos, imaginal disks, and adult heads. Clones with EK designations were selected for initial sequencing. Those with EP designations are a subset of clones that were sequenced from the 3' end. These were clones that did not initially overlap other contigs and where the 5' end did not read into vector (i.e. inserts >~500bp). Vector: pCDNA-sk+ standard.
Library Synonyms
Reported As
Symbol Synonym
Library References
Personal communication to FlyBase	Carlson, 2005.9.12, FlyTag EST project. FlyTag EST project. [FBrf0188689]
Unpublished	Platt et al., 2005, FlyTag CK02 EST Project. FlyTag CK02 EST Project. [FBrf0186301] Kopczynski et al., 2004, FlyTag CK01 EST Project. FlyTag CK01 EST Project. [FBrf0185710]
Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs

References ( 0 )
Personal communication to FlyBase	Carlson, 2005.9.12, FlyTag EST project. FlyTag EST project. [FBrf0188689]
Unpublished	Platt et al., 2005, FlyTag CK02 EST Project. FlyTag CK02 EST Project. [FBrf0186301] Kopczynski et al., 2004, FlyTag CK01 EST Project. FlyTag CK01 EST Project. [FBrf0185710]