A Database of Drosophila Genes & Genomes

FB2008_06, released July 3, 2008
 

Clone Dmel\bs31g09

General Information
Symbol Dmel\bs31g09 Species D. melanogaster
Name bs31g09 FlyBase ID FBcl0049035
Feature type cDNA_clone Created / Updated 2005-11-01/2006-08-19
Computed gene(s) Dmel\Dcp2
Collection Status N/A
Known Problems none
Library BS
Strain y w [67cl]
Tissue Source adult stage testis & seminal vesicle & ejaculatory duct
Vector pBluescript_SK(-)  
hide Sequence Data of the Insert
Full Length Sequence
Total bases 192
GenBank
Full Length sequence data GCACCAGCAACGATTCAATACATATACAGCTCGTAGGTCAACAATCTAGC
GTTGCTCGCGTCGCTGACTTTACAAAAAGTGCTAAATATCAACAATAACA
ATAACCAGCACAGCAAGAACAACAACCACAGCGACAATAGCAATAGCAAA
CAACACGAGCAACAAAAACAGCAGCAGCAACCACAACGACGA
hide Library Information
Comments
  • A testis Drosophila cDNA library was constructed by Justen Andrews in Brian Oliver's laboratory at the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) which is part of the National Institutes of Health (NIH) at Bethesda, MD, USA. Poly (A) + RNA was prepared from dissected testes from 1-5 day old y w [67cl] Drosophila melanogaster flies, after removal of the paragonia and inclusion of the ejaculatory ducts and seminal vesicles. The size fractionated cDNA (1-6kb) was directionally cloned in the Stratagene Uni-Zap XR vector using EcoRI and XhoI restriction sites. pBluescript SK (-) is produced after excision. The host strain is E.coli SOLR.
hide Library Synonyms
Reported As
Symbol Synonym
hide Library References
Research paper
Andrews et al., 2000, Genome Res. 10(12): 2030--2043
Gene discovery using computational and microarray analysis of transcription in the Drosophila melanogaster testis. [FBrf0132348]
hide Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs
hide References ( 0 )
Research paper
Andrews et al., 2000, Genome Res. 10(12): 2030--2043
Gene discovery using computational and microarray analysis of transcription in the Drosophila melanogaster testis. [FBrf0132348]