Clone Dmel\bs31g09

General Information
Symbol	Dmel\bs31g09	Species	D. melanogaster
Name	bs31g09	FlyBase ID	FBcl0049035
Feature type	cDNA_clone	Created / Updated	2005-11-01/2006-08-19
Computed gene(s)	Dmel\Dcp2

Collection Status	N/A
Known Problems	none
Library	BS
Strain	y w [67cl]
Tissue Source	adult stage testis & seminal vesicle & ejaculatory duct
Vector	pBluescript_SK(-)
Sequence Data of the Insert
Full Length Sequence
Total bases	192
GenBank
Full Length sequence data	GCACCAGCAACGATTCAATACATATACAGCTCGTAGGTCAACAATCTAGC GTTGCTCGCGTCGCTGACTTTACAAAAAGTGCTAAATATCAACAATAACA ATAACCAGCACAGCAAGAACAACAACCACAGCGACAATAGCAATAGCAAA CAACACGAGCAACAAAAACAGCAGCAGCAACCACAACGACGA
Library Information
Comments	A testis Drosophila cDNA library was constructed by Justen Andrews in Brian Oliver's laboratory at the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) which is part of the National Institutes of Health (NIH) at Bethesda, MD, USA. Poly (A) + RNA was prepared from dissected testes from 1-5 day old y w [67cl] Drosophila melanogaster flies, after removal of the paragonia and inclusion of the ejaculatory ducts and seminal vesicles. The size fractionated cDNA (1-6kb) was directionally cloned in the Stratagene Uni-Zap XR vector using EcoRI and XhoI restriction sites. pBluescript SK (-) is produced after excision. The host strain is E.coli SOLR.
Library Synonyms
Reported As
Symbol Synonym
Library References
Research paper	Andrews et al., 2000, Genome Res. 10(12): 2030--2043 Gene discovery using computational and microarray analysis of transcription in the Drosophila melanogaster testis. [FBrf0132348]
Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs

References ( 0 )
Research paper	Andrews et al., 2000, Genome Res. 10(12): 2030--2043 Gene discovery using computational and microarray analysis of transcription in the Drosophila melanogaster testis. [FBrf0132348]