Clone Dmel\AT17440

General Information
Symbol	Dmel\AT17440	Species	D. melanogaster
Name	AT17440	FlyBase ID	FBcl0026683
Feature type	cDNA_clone	Created / Updated	2005-11-01/2006-08-19
Computed gene(s)	Dmel\pcm

Collection Status	BDGP
Known Problems	none
Library	AT
Strain	Oregon R
Tissue Source	adult stage testis & seminal vesicle
Vector	pOTB7
Sequence Data of the Insert
5' Sequence
Total bases	366
GenBank	BF501867
5' sequence data	GTGCATCGAGCTACCAAATGCGGCTAGAACCGTTTTCTTCCCGGGATTTC CCACCATGCAGCATCTGCCCTTCGATTTCGAGCTGCGCAACGACCGCGTC AAGGTGTTCGAACAGGTCAGTCGCAACCAGAACATTGTGCTAAAACCACG CAAGCGCCAGCTGGAGGACACACTGACGGCGGTGGCCTCCCAGTACCTCG GGAAGGTGATCCACGTCGGCTGGCCGCATCTCGTCAAGGCGATCGTGGTG CGCGTGGCCACGCGAGATCAGCGCGTCGACAGCGAGGGAATCACGCTAAA CGATTCGCGGCGTTTCGACTCGGAATGCAAGGCACTGCAGGAACACTTTA TCACTCGTATGGGAAT
Library Information
Comments	The AT (adult testes) library was made from RNA extracted from Drosophila adult male testes. mRNA source: Adult male testes and seminal vesicles hand dissected from 0-3 day old non-isogenic Ore-R males from a population cage, polyA+ selected twice, kindly provided by J. Pringle and M. Fuller. cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; cDNA size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned directly into EcoRI/XhoI-digested pOTB7 plasmid. cDNAs were transformed into DH5-alpha strain (Gibco/BRL), or for AT121nn clones, into DH5-alpha TonA.
Library Synonyms
Reported As
Symbol Synonym	AT (Stapleton et al., 2002)
Library References
Research paper	Stapleton et al., 2002, Genome Res. 12(8): 1294--1300 The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs

References ( 1 )
Research paper	Stapleton et al., 2002, Genome Res. 12(8): 1294--1300 The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]