A Database of Drosophila Genes & Genomes

FB2008_06, released July 3, 2008
 

Clone Dmel\AT23995

General Information
Symbol Dmel\AT23995 Species D. melanogaster
Name AT23995 FlyBase ID FBcl0026557
Feature type cDNA_clone Created / Updated 2005-11-01/2006-08-19
Computed gene(s) Dmel\pcm
Collection Status BDGP
Known Problems none
Library AT
Strain Oregon R
Tissue Source adult stage testis & seminal vesicle
Vector pOTB7  
hide Sequence Data of the Insert
5' Sequence
Total bases 389
GenBank BF488539
5' sequence data GTGCATCGAGCTACCAAATGCGGCTAGAACCGTTTTCTTCCCGGGATTTC
CCACCATGCAGCATCTGCCCTTCGATTTCGAGCTGCGCAACGACCGCGTC
AAGGTGTTCGAACAGGTCAGTCGCAACCAGAACATTGTGCTAAAACCACG
CAAGCGCCAGCTGGAGGACACACTGACGGCGGTGGCCTCCCAGTACCTCG
GGAAGGTGATCCACGTCGGCTGGCCGCATCTCGTCAAGGCGATCGTGGTG
CGCGTGGCCACGCGAGATCAGCGCGTCGACAGTGAGGGAATCACGCTAAA
CGATTAGTGGTGTTTCGACTCGGAATGCAAGGCACTGCAGGAACACTTTA
TTACTCGTATGGGAATACAGTTTGGCAACTATGATGTGC
hide Library Information
Comments
  • The AT (adult testes) library was made from RNA extracted from Drosophila adult male testes. mRNA source: Adult male testes and seminal vesicles hand dissected from 0-3 day old non-isogenic Ore-R males from a population cage, polyA+ selected twice, kindly provided by J. Pringle and M. Fuller. cDNA made using Stratagene ZAP-cDNA synthesis kit; oligo(dT) primed with XhoI site at end of primer for first strand synthesis; EcoRI adapter on 5' ends of clones; cDNA size fractionated on Sephacryl S-500--approximately 1-6kb. cDNA directionally cloned directly into EcoRI/XhoI-digested pOTB7 plasmid. cDNAs were transformed into DH5-alpha strain (Gibco/BRL), or for AT121nn clones, into DH5-alpha TonA.
hide Library Synonyms
Reported As
Symbol Synonym
hide Library References
Research paper
Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]
hide Synonyms & Secondary IDs ( 0 )
Reported As
Symbol Synonym
Secondary FlyBase IDs
hide References ( 1 )
Research paper
Stapleton et al., 2002, Genome Res. 12(8): 1294--1300
The Drosophila Gene Collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. [FBrf0152058]